Review



cas9-puro/sgrna(agctgttgctccctacctcgggg) delivery plasmid pspcas9(bb)-2a-puro (px459) v2.0  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Addgene inc cas9-puro/sgrna(agctgttgctccctacctcgggg) delivery plasmid pspcas9(bb)-2a-puro (px459) v2.0
    Cas9 Puro/Sgrna(Agctgttgctccctacctcgggg) Delivery Plasmid Pspcas9(Bb) 2a Puro (Px459) V2.0, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9-puro/sgrna(agctgttgctccctacctcgggg) delivery plasmid pspcas9(bb)-2a-puro (px459) v2.0/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    cas9-puro/sgrna(agctgttgctccctacctcgggg) delivery plasmid pspcas9(bb)-2a-puro (px459) v2.0 - by Bioz Stars, 2026-03
    90/100 stars

    Images



    Similar Products

    px459 cyfip2 ko dna plasmid  (Thermo Fisher)
    99
    Thermo Fisher px459 cyfip2 ko dna plasmid
    Px459 Cyfip2 Ko Dna Plasmid, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/px459 cyfip2 ko dna plasmid/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    px459 cyfip2 ko dna plasmid - by Bioz Stars, 2026-03
    99/100 stars
    		  Buy from Supplier
    px459 py30 casmini puro plasmid  (TaKaRa)
    97
    TaKaRa px459 py30 casmini puro plasmid
    Px459 Py30 Casmini Puro Plasmid, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/px459 py30 casmini puro plasmid/product/TaKaRa
    Average 97 stars, based on 1 article reviews
    px459 py30 casmini puro plasmid - by Bioz Stars, 2026-03
    97/100 stars
    		  Buy from Supplier
    cas9-puro/sgrna(agctgttgctccctacctcgggg) delivery plasmid pspcas9(bb)-2a-puro (px459) v2.0  (Addgene inc)
    90
    Addgene inc cas9-puro/sgrna(agctgttgctccctacctcgggg) delivery plasmid pspcas9(bb)-2a-puro (px459) v2.0
    Cas9 Puro/Sgrna(Agctgttgctccctacctcgggg) Delivery Plasmid Pspcas9(Bb) 2a Puro (Px459) V2.0, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9-puro/sgrna(agctgttgctccctacctcgggg) delivery plasmid pspcas9(bb)-2a-puro (px459) v2.0/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    cas9-puro/sgrna(agctgttgctccctacctcgggg) delivery plasmid pspcas9(bb)-2a-puro (px459) v2.0 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    pspcas9(bb)-2a-puro (px459) plasmid  (Addgene inc)
    90
    Addgene inc pspcas9(bb)-2a-puro (px459) plasmid
    Pspcas9(Bb) 2a Puro (Px459) Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pspcas9(bb)-2a-puro (px459) plasmid/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    pspcas9(bb)-2a-puro (px459) plasmid - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    px459 background  (Addgene inc)
    96
    Addgene inc px459 background
    Px459 Background, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/px459 background/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    px459 background - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    pspcas9 bb 2a puro px459 v2 0 gift from feng zhang addgene plasmid 62988  (Addgene inc)
    96
    Addgene inc pspcas9 bb 2a puro px459 v2 0 gift from feng zhang addgene plasmid 62988
    Pspcas9 Bb 2a Puro Px459 V2 0 Gift From Feng Zhang Addgene Plasmid 62988, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pspcas9 bb 2a puro px459 v2 0 gift from feng zhang addgene plasmid 62988/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    pspcas9 bb 2a puro px459 v2 0 gift from feng zhang addgene plasmid 62988 - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    pspcas9 bb 2apuro px459  (Addgene inc)
    96
    Addgene inc pspcas9 bb 2apuro px459
    Pspcas9 Bb 2apuro Px459, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pspcas9 bb 2apuro px459/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    pspcas9 bb 2apuro px459 - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    cas offinder  (Addgene inc)
    96
    Addgene inc cas offinder
    Cas Offinder, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas offinder/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    cas offinder - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    px459  (Addgene inc)
    93
    Addgene inc px459
    Px459, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/px459/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    px459 - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier

    Image Search Results